86
|
Novus Biologicals
pclxsn retroviral expression vector Pclxsn Retroviral Expression Vector, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pclxsn retroviral expression vector/product/Novus Biologicals Average 86 stars, based on 1 article reviews
pclxsn retroviral expression vector - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
95
|
TaKaRa
dsred express Dsred Express, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dsred express/product/TaKaRa Average 95 stars, based on 1 article reviews
dsred express - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
95
|
Addgene inc
taggcaccatggtccactgcag mythdf1 e4 Taggcaccatggtccactgcag Mythdf1 E4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/taggcaccatggtccactgcag mythdf1 e4/product/Addgene inc Average 95 stars, based on 1 article reviews
taggcaccatggtccactgcag mythdf1 e4 - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
93
|
Addgene inc
12urab 12urab, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/12urab/product/Addgene inc Average 93 stars, based on 1 article reviews
12urab - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
95
|
TaKaRa
pdsred express Pdsred Express, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pdsred express/product/TaKaRa Average 95 stars, based on 1 article reviews
pdsred express - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
95
|
TaKaRa
phek293 ultra expression vector i Phek293 Ultra Expression Vector I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phek293 ultra expression vector i/product/TaKaRa Average 95 stars, based on 1 article reviews
phek293 ultra expression vector i - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
95
|
TaKaRa
pdsred‑express‑1 vectors Pdsred‑Express‑1 Vectors, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pdsred‑express‑1 vectors/product/TaKaRa Average 95 stars, based on 1 article reviews
pdsred‑express‑1 vectors - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
95
|
TaKaRa
pdsred express n1 plasmid Pdsred Express N1 Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pdsred express n1 plasmid/product/TaKaRa Average 95 stars, based on 1 article reviews
pdsred express n1 plasmid - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
94
|
TaKaRa
ec mlck 2 expression vector Ec Mlck 2 Expression Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ec mlck 2 expression vector/product/TaKaRa Average 94 stars, based on 1 article reviews
ec mlck 2 expression vector - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
94
|
Genecopoeia
pez m06 eukaryotic expression vector Pez M06 Eukaryotic Expression Vector, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pez m06 eukaryotic expression vector/product/Genecopoeia Average 94 stars, based on 1 article reviews
pez m06 eukaryotic expression vector - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
94
|
Genecopoeia
pez lv201 vector Pez Lv201 Vector, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pez lv201 vector/product/Genecopoeia Average 94 stars, based on 1 article reviews
pez lv201 vector - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pet Pet, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pet/product/Addgene inc Average 93 stars, based on 1 article reviews
pet - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |