expression vector Search Results


86
Novus Biologicals pclxsn retroviral expression vector
Pclxsn Retroviral Expression Vector, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pclxsn retroviral expression vector/product/Novus Biologicals
Average 86 stars, based on 1 article reviews
pclxsn retroviral expression vector - by Bioz Stars, 2026-02
86/100 stars
  Buy from Supplier

95
TaKaRa dsred express
Dsred Express, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dsred express/product/TaKaRa
Average 95 stars, based on 1 article reviews
dsred express - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

95
Addgene inc taggcaccatggtccactgcag mythdf1 e4
Taggcaccatggtccactgcag Mythdf1 E4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taggcaccatggtccactgcag mythdf1 e4/product/Addgene inc
Average 95 stars, based on 1 article reviews
taggcaccatggtccactgcag mythdf1 e4 - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

93
Addgene inc 12urab
12urab, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/12urab/product/Addgene inc
Average 93 stars, based on 1 article reviews
12urab - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

95
TaKaRa pdsred express
Pdsred Express, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pdsred express/product/TaKaRa
Average 95 stars, based on 1 article reviews
pdsred express - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

95
TaKaRa phek293 ultra expression vector i
Phek293 Ultra Expression Vector I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phek293 ultra expression vector i/product/TaKaRa
Average 95 stars, based on 1 article reviews
phek293 ultra expression vector i - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

95
TaKaRa pdsred‑express‑1 vectors
Pdsred‑Express‑1 Vectors, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pdsred‑express‑1 vectors/product/TaKaRa
Average 95 stars, based on 1 article reviews
pdsred‑express‑1 vectors - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

95
TaKaRa pdsred express n1 plasmid
Pdsred Express N1 Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pdsred express n1 plasmid/product/TaKaRa
Average 95 stars, based on 1 article reviews
pdsred express n1 plasmid - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

94
TaKaRa ec mlck 2 expression vector
Ec Mlck 2 Expression Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ec mlck 2 expression vector/product/TaKaRa
Average 94 stars, based on 1 article reviews
ec mlck 2 expression vector - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

94
Genecopoeia pez m06 eukaryotic expression vector
Pez M06 Eukaryotic Expression Vector, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pez m06 eukaryotic expression vector/product/Genecopoeia
Average 94 stars, based on 1 article reviews
pez m06 eukaryotic expression vector - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

94
Genecopoeia pez lv201 vector
Pez Lv201 Vector, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pez lv201 vector/product/Genecopoeia
Average 94 stars, based on 1 article reviews
pez lv201 vector - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

93
Addgene inc pet
Pet, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet/product/Addgene inc
Average 93 stars, based on 1 article reviews
pet - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

Image Search Results